If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USADepartment of Pediatrics, Texas Children's Cancer Center, Baylor College of Medicine, Houston, Texas, USA
Department of Pediatrics, Texas Children's Cancer Center, Baylor College of Medicine, Houston, Texas, USADan L. Duncan Cancer Center, Baylor College of Medicine, Houston, Texas, USA
Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USADepartment of Pediatrics, Texas Children's Cancer Center, Baylor College of Medicine, Houston, Texas, USA
Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, USADepartment of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USADan L. Duncan Cancer Center, Baylor College of Medicine, Houston, Texas, USA
Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, USADepartment of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USADan L. Duncan Cancer Center, Baylor College of Medicine, Houston, Texas, USA
Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, USADepartment of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USADepartment of Pediatrics, Texas Children's Cancer Center, Baylor College of Medicine, Houston, Texas, USADan L. Duncan Cancer Center, Baylor College of Medicine, Houston, Texas, USA
We applied whole-genome sequencing (WGS) to children diagnosed with neoplasms and found to carry apparently balanced constitutional translocations to discover novel genic disruptions.
Methods
We applied the structural variation (SV) calling programs CREST, BreakDancer, SV-STAT, and CGAP-CNV, and we developed an annotative filtering strategy to achieve nucleotide resolution at the translocations.
Results
We identified the breakpoints for t(6;12)(p21.1;q24.31), disrupting HNF1A in a patient diagnosed with hepatic adenomas and maturity-onset diabetes of the young (MODY). Translocation as the disruptive event of HNF1A, a gene known to be involved in MODY3, has not been previously reported. In a subject with Hodgkin lymphoma and subsequent low-grade glioma, we identified t(5;18)(q35.1;q21.2), disrupting both SLIT3 and DCC, genes previously implicated in both glioma and lymphoma.
Conclusion
These examples suggest that implementing clinical WGS in the diagnostic workup of patients with novel but apparently balanced translocations may reveal unanticipated disruption of disease-associated genes and aid in prediction of the clinical phenotype.
Although potentially harmless, balanced translocations can alter gene expression or function if the breakpoints occur within genes or regulatory regions. Balanced de novo translocations (not inherited from a parent) were seen with a prevalence of ~0.08% in a large cohort of prenatal cytogenetic results.
Translocations can result in gene fusions or disruptions, and both can be identified through whole-genome sequencing (WGS) with structural variation (SV) programs reporting translocation events. We used paired-end Illumina WGS on two subjects with constitutional balanced translocations, applied three SV calling algorithms (CREST, BreakDancer, and SV-STAT), and developed an annotative filtering strategy to identify the precise breakpoints of novel genic disruptions.
Both patients and parents (when available) were entered into a human subjects protocol approved by the institutional review board of Baylor College of Medicine.
The first patient, FCP637, is a 12-year-old girl with dysmorphic craniofacial features, seizure disorder, vesicoureteral reflux, patent foramen ovale and mildly dilated aortic root, Hashimoto thyroiditis, moderate speech delay (receptive language superior to expressive), poor speech articulation with normal hearing, friendly demeanor, subclinical seizures, and hypotonia. Diffuse hepatic adenomas were discovered incidentally and confirmed by needle biopsy. Perturbation of HNF1A (TCF1) is associated with familial hepatic adenomas and with maturity-onset diabetes of the young type 3 (MODY3) (OMIM 142410 and OMIM 600496, respectively).
MODY3 was diagnosed ~2 years after adenoma discovery. Peripheral blood karyotype revealed an apparently balanced translocation between 6p11.1 and 12q24.2. Karyotype analyses of both parents were normal, confirming the translocation was de novo. Clinical Sanger sequence analysis of HNF1A was normal, and an oligonucleotide chromosomal microarray analysis (Molecular Genetics Laboratory, Baylor College of Medicine) with exon coverage of HNF1A showed no copy-number variation, or gain or loss of material. However, the microarray results included a microdeletion of chromosome 17q21.31, encompassing 0.341–1.328 Mb. This results in a well-described microdeletion syndrome (Koolen–de Vries syndrome, OMIM 610443), which includes many of the developmental problems seen in the patient.
The second patient, FCP672, is a male who was diagnosed at 5 years of age by lymph node biopsy with classic Hodgkin lymphoma of mixed cellularity with interfollicular growth pattern (OMIM 236000). The patient displayed unexplained growth deceleration and obesity but no apparent developmental delay. Bone marrow at the time of diagnosis demonstrated an apparently balanced translocation t(5;18)(q35.1;q21.2) in all lymphoma cells analyzed. Subsequent peripheral blood and skin fibroblast karyotype analyses demonstrated the translocation in all cells, confirming it was constitutional. A focused chromosomal analysis of both parents found no rearrangements for chr5 or chr18. Two chromosomal microarrays were performed (version V7.2CMA, repeated in 2013 as CMA-HR+SNP(V9.1.1)); these failed to detect loss or gain of genomic material in the region of the translocation. After completing treatment for lymphoma, the patient was diagnosed by magnetic resonance imaging with a brain lesion suggestive of low-grade glioma and is being followed with serial imaging without biopsy.
Methods
Genomic DNA from both patients and one maternal parental sample (FCP664, the mother of FCP672) underwent WGS (Illumina, San Diego, CA;, 100-bp paired ends, 400-bp insert size, 30× coverage) at the Human Genome Sequencing Center, Baylor College of Medicine, following previously described protocols and quality metrics with alignment to HG19.
Structural variation. We applied CREST (http://www.stjuderesearch.org/site/lab/zhang), SV-STAT (https://gitorious.org/svstat), and BreakDancer (http://breakdancer.sourceforge.net/) (using default parameters, apart from BreakDancer q ≥ 50) and intersected outputs using 600-bp windows. Filtering metrics were as follows: CREST, ≥4 right/left soft clips and ≥20 reads coverage; BreakDancer, ≥20 anomalous read pairs; and SV-STAT, “PASS” filter calls only. We excluded translocations between autosomal and X/Y chromosomes due to mismapping. As controls, we used the BAB195 48X whole genome
and an additional set of 69 samples from normal tissues of adults from the Cancer Genome Atlas. We removed any proband translocation within 600 bp of control translocations. The analyst was aware of t(6;12) (p11.1;q24.2) reported in FCP637 but was blinded to the cytogenetic breakpoints for FCP672.
Copy-number variation. We applied CGAP-CNV, an in-house whole-genome copy-number program
, to obtain microdeletion breakpoint windows. These were manually refined using Integrative Genomics Viewer (http://www.broadinstitute.org/igv/).
Single-nucleotide variation and insertions and deletions. For samples and a large set of controls (1,079 randomly selected nontumor whole exomes from the Atherosclerosis Risk in Communities cohort, run on the same design), variants were called with ATLAS Suite (ATLAS-SNP: http://sourceforge.net/p/atlas2/wiki/Atlas-SNP/ and ATLAS-INDEL: http://sourceforge.net/p/atlas2/wiki/Atlas-Indel/) and Pindel (http://gmt.genome.wustl.edu/packages/pindel/). (≤200-bp insertions and deletions) and annotated with ANNOVAR, dbSNP, COSMIC, and Exome Variant Server. Variants were filtered for ≥20/30% variant allele fraction in whole-exome sequencing and WGS, respectively, ≤1% dbSNP minor allele frequency, and ≤1.5% presence in the control set. Variants were manually reviewed in Integrative Genomics Viewer, with the BAB195 40X whole genome as a visual control.
Breakpoint reporting. We utilized the recently described Next-Gen Cytogenetics nomenclature in reporting breakpoints from cytogenetic karyotype and WGS.
Breakpoint databases queried, software, and annotation resources. Mittelman Database, Atlas of Genetics and Cytogenetics in Oncology and Haematology, TICdb, and DACRO. Calling, annotation, and database sources can be found by an Internet search of listed names and/or URL; for brevity, we could not list individual references.
Results
The breakpoints for the proband with MODY3 and hepatic adenomas (FCP637), using the newly proposed genomic nomenclature, are: 46,XX,t(6;12)(p11.1;q24.2)dn.seq[GRCh37/hg19]t(6;12)(12qter→12q24.31(121,420,346)::6p21.1(44,758,577)→6qter;12pter→12q24.31(121,420,33{1–2})::6p21.1(44,758,57{3-2})→6pter)dn.
On chr6, this is a nongenic region ~35 kb away from SUPT3H and ~336 kb from CDC5L in the telomeric direction. On chr12, the breakpoint occurs in the first intron of HNF1A, likely disrupting gene function, as the open reading frame is broken into two segments (Figure 1a and Supplementary Table S1 online).
Figure 1Translocation characterization and polymerase chain reaction (PCR) confirmation of t(6;12)(p21.1;q24.31). (a) Depiction of the derivative chromosomes and gene rearrangements. The der6 allele has HNF1A exons 2 to 10 in the reverse direction and ~35 kb of nongenic sequence from the terminus of SUPT3H. The der12 allele displays forward transcription of HNF1A, ending in a large noncoding region of chr6, prior to the CDC5L gene, which is transcribed on the opposite strand. (b) Breakpoint characterization: there is a 2-bp microhomology at the breakpoint (CA, orange), deleted in a 5-bp deletion on chr6 (purple and orange underline). A 13-bp deletion occurs on chr12 (purple underline), maintaining the CA microhomology. Arrows detail the breakpoint bases, with the GRCh37 reference sequence on the side. (c) PCR validation: primers (6Fb and 6Rb; 12Fb and 12Rb) amplified the wild-type chromosomes 6 and 12. The proband’s mother (FCP638) and a 1000 Genomes sample (HG117) were also tested. Pairing primers 6Fb with 12Fb and 6Rb with 12Rb amplifies the expected translocation products in the proband.
For FCP672, the proband with Hodgkin lymphoma and subsequent putative low-grade glioma, the breakpoints are: 46,XY,t(5;18)(q35.1;q21.2)dn.seq[GRCh37/hg19] t(5;18)(5pter→5q34(168,236,81{0–3})::18q21.2(50,099,{299–302})→18qter;18pter→18q21.2(50,099,30{2–3})::5q34(168,236,81{5–6})→5qter)dn.
On chr5, the breakpoint occurs in intron 8 of SLIT3 and the first intron of DCC on chr18. DCC is forward-transcribed, whereas SLIT3 is transcribed in the negative direction. Again, from reconstructing the derivative chromosomes (Figure 2a and Supplementary Table S1 online), we reason both the DCC and SLIT3 open reading frames are disrupted.
Figure 2Translocation characterization and polymerase chain reaction (PCR) confirmation of t(5;18)(q35.1;q21.2). (a) The der5 allele displays exons 9–36 through the terminus of SLIT3, joined in intron 8 of SLIT3 and intron 1 of DCC, with DCC exons 2 through 29 in the opposite direction. The der18 allele shows the first exon of DCC in the forward direction, ending in intron 8 of SLIT3, which is transcribed in the opposite direction. (b) Breakpoint characterization: there is a 4-bp region of homology between chr5 and chr18 at the breakpoint (CACA, orange), with a 2-bp deletion on chr5 (purple underline). On chr18, there is no loss of genomic material. Arrows and coordinates detail the breakpoint bases from the GRCh37 reference sequence. (c) PCR validation: primers (5Fb and 5Rb; 18Fb and 18Rb) amplified the wild-type chr5 and chr18. The proband’s mother (FCP664) and a 1000 Genomes sample (HG117) were also tested. Pairing primers 5Fb with 18Rb and 5Rb with 18Fb amplifies the expected translocation product. Nested PCR was used to confirm the der18 product and eliminate nonspecific bands.
We validated translocations using polymerase chain reaction (PCR) assays (Figures 1 and 2), followed by Sanger sequencing. As expected, all samples from the patients, mother, and control lines contained PCR products from intact copies of the involved chromosomes. PCR reactions spanning the putative breakpoints reveal sequencing that aligns to reconstructed derivatives in the probands. For t(6;12)(p21.1;q24.31), Sanger sequencing of the der6 product revealed an overlap of only 2 bp between chr6 and chr12: AGTATAAAAACAGAGCTAGGATTAGGATG with a 5-bp deletion of chr6 (Figure 1b). For the der12 product, Sanger sequencing results show a deletion of 13 bp in the breakpoint region and a 12-bp region of homology to both chr6 and chr12, adjacent to the translocation breakpoint. This indicates a balanced translocation with minimal sequence loss. Similarly, for t(5;18)(q34;q21) (Figure 2b), we found a 4-bp region of homology (CACA) between chr5 and chr18 at the region of the breakpoint. There is a 2-bp deletion on chr5 and no loss on chr18. These WGS results showing nearly precise breakpoints are consistent with the normal microarray results.
As mentioned, FCP637 carries a well-described heterozygous microdeletion detected within a megabase range by clinical array comparative genomic hybridization. We determined the microdeletion breakpoints as: 46,XX.arr[hg19]17q21.31.seq[GRCh37/hg19]del(17)(pter→q21.31(43691189)::q21.31(44354365) →qter) (Supplementary Figure S1 online). This is an ~663-kb span, which is typical of previously reported microdeletions, and it deletes the reported causal gene, KANSL1.
To determine if the clinical phenotypes might result from mutations near the translocation breakpoints, we reviewed the single-nucleotide variations and insertions and deletions within 1 kb of transcription start/stop from whole-exome and genome for DCC, SLIT3, and HNF1A. No rare coding or intronic variants that passed visual inspection were identified in HNF1A, and the noncoding region ~35 kb downstream from SUPT3H was not further analyzed for variants. Interestingly, RUNX2 is ~537 kb from the chr6 breakpoint, and CDC5L is ~326 kb upstream. RUNX2 is a global transcriptional regulator (OMIM 600211); CDC5L is similar in sequence to cell-cycle regulatory genes (OMIM 602868). Position effects, such as distal gene disruptions ablating or inducing long-range cis-regulation, have been reported in a t(6;7)(p21.1;q36) breakpoint ~735 kb upstream of RUNX2 (although the proband phenotype is markedly dissimilar to ours).
Position effects present a challenge due to large numbers of possible affected genes, and we did not have RNA-sequencing data for further analysis. For SLIT3, only one rare (rs34260167, minor allele frequency = 0.006) maternal (FCP664) missense variant in exon 18 of SLIT3 (chr5, 168180047 C>T, S629N) was found in whole exome, and no rare variants were identified in the proband FCP672. Whole-genome variants produced far more results (>2k per individual), but after filtering and visualization, we found only the above maternal coding variant and a novel intronic variant at the site of the translocation in SLIT3 (chr5, IVS8, 168236814 A>C). All other variants were novel intronic events of unknown significance (~140 per individual).
Discussion
We identified two novel disruptive constitutional translocations occurring in introns of HNF1A, SLIT3, and DCC. We found no previous reports of a constitutional balanced translocation involving HNF1A. The prior knowledge of HNF1A underlying MODY3 with hepatic adenomas strongly supports our novel finding of HNF1A disruption caused by a translocation as the underlying genetic defect in FCP637.
) and two prior reports identified constitutional balanced translocations in other forms of MODY-diagnosed individuals, one affecting HNF4A [t(3;20)(p21.2;q12)]
Maturity-onset diabetes of the young caused by a balanced translocation where the 20q12 break point results in disruption upstream of the coding region of hepatocyte nuclear factor-4alpha (HNF4A) gene.
MODY-like diabetes associated with an apparently balanced translocation: possible involvement of MPP7 gene and cell polarity in the pathogenesis of diabetes.
Our finding emphasizes the benefits of obtaining intronic and nongenic sequences through WGS, because in this case clinical exon tests of HNF1A did not find coding mutations and array comparative genomic hybridization did not indicate any material loss of HNF1A.
In addition to reports of germ-line variants of HNF1A (point mutations and small frameshift mutations) in MODY3 patients, Bluteau et al.
reported biallelic mutations of HNF1A in adenomas of affected individuals, indicative of a two-hit predisposition model. Unfortunately, there was insufficient tissue from the diagnostic biopsy to look for alterations of HNF1A in the hepatomas.
The WGS data fully resolved breakpoints of the 17q21.31 microdeletion, consistent with size and genomic region in other reports. We found no other published cases of MODY3 and hepatic adenomas concurrent with Koolen–de Vries syndrome; these two conditions appear to be the result of one patient carrying two unrelated genomic events, similar to recent reports from exome sequencing tests.
We found no previous report of a constitutional balanced translocation disrupting both DCC and SLIT3. However, we have identified reports with translocations in the same or similar cytobands (5q34 and 18q21) in hematological malignancies (Supplementary Table S2 online). The analyses focused on BCL2 in 18q21; however, the translocations were not characterized to gene resolution. DCC (deleted in colorectal cancer) at 18q21 has been extensively studied as a tumor suppressor in colorectal cancers but has also shown loss in lymphoid malignancies
showed SLIT3 inactivation via 5′ hypermethylation in 21/60 (~35%) glioma tumors. In addition, a miRNA (mir-218-2) was recently reported in SLIT3 intron 22, and mir-218-2 expression decreased with concurrent reduction of SLIT3 transcript.
Our t(5;18)(q34;q21) breakpoint is upstream of mir-218-2 and thus may disrupt miRNA transcription. The implications for cancer and DCC and the UNC5s/SLITs/ROBOs gene families have been recently reviewed.
Our work suggests further analysis of germ-line changes in SLIT3 should be considered in glioma patients.
In clinical genetics, the counseling and prediction of future clinical manifestations for a child with a previously uncharacterized balanced translocation has been challenging. Although both of the patients described had de novo translocations, previous work identified balanced translocations involving chr3 transmitted through multiple generations, resulting in autosomal dominant familial renal cell cancer.
A constitutional balanced t(3;8)(p14;q24.1) translocation results in disruption of the TRC8 gene and predisposition to clear cell renal cell carcinoma.
The integration of clinical WGS, with appropriate data analysis for precise mapping of rearrangements, into diagnostic testing may provide important knowledge of the genes disrupted by balanced translocations and their potential role in disease manifestation. Current pediatric practice does not routinely include WGS, particularly for balanced (as based on normal microarray analysis) or de novo balanced translocations lacking overt phenotypes. Our findings emphasize the need to resolve to the base-pair level the breakpoints of constitutional balanced translocations by WGS to provide optimal care.
Disclosure
The authors declare no conflict of interest.
Acknowledgements
The authors acknowledge the following funding sources: Cancer Prevention Research Institute of Texas RP10189 and National Institutes of Health R01-CA138836 to S.E.P.; National Institute of General Medical Sciences, Institutional Research and Academic Career Development K12 GM084897-06 (to D.I.R.); Keck Center for Interdisciplinary Bioscience Training of the Gulf Coast Consortia T15 LM007093 (to C.F.D.); and National Institute of General Medical Sciences T32 GM08307-22 (in support of K.M.H.).
Maturity-onset diabetes of the young caused by a balanced translocation where the 20q12 break point results in disruption upstream of the coding region of hepatocyte nuclear factor-4alpha (HNF4A) gene.
MODY-like diabetes associated with an apparently balanced translocation: possible involvement of MPP7 gene and cell polarity in the pathogenesis of diabetes.
A constitutional balanced t(3;8)(p14;q24.1) translocation results in disruption of the TRC8 gene and predisposition to clear cell renal cell carcinoma.
03154-3&id=gr1.jpg){kind=link}
03154-3&id=gr2.jpg){kind=link}